Class Name: DNA
Method Name: getComplement
Arg Types: String
Return Type: String
Implement a class DNA, which contains a method getComplement. getComplement
takes a String representing a strand of DNA and returns the complement of that
strand, as a String.
DNA is composed of the following four bases: adenine, guanine, thymine, and
cytosine. Two strands of DNA are considered complements of each other if all
of the following conditions are met:
- they are of equal length
- for each adenine in the first strand, a thymine is located in the
exact same position of the second strand
- for each thymine in the first strand, an adenine is located in the
exact same position of the second strand
- for each guanine in the first strand, a cytosine is located in the
exact same position of the second strand
- for each cytosine in the first strand, a guanine is located in the
exact same position of the second strand
In both the input String and return String, let A stand for adenine, T for
thymine, C for cytosine and G for guanine and let each character in the String
represent a position in the DNA strand.
Here is the method signature:
String getComplement(String strStrand);
Be sure your method is public.
* strStrand has length 1 to 50, inclusive.
* strStrand contains only the characters 'A', 'T', 'C', and 'G'.
Examples:
* If the input is "GAAACT", the method should return "CTTTGA"
* If the input is "ACCAAAAGCTGCAGTATGA", the method should return
"TGGTTTTCGACGTCATACT"
* If the input is "TAGGTCTCACTTAGCTTTCGTCCCTATAGTATATAGCTCCCAACCATCCA", the
method should return "ATCCAGAGTGAATCGAAAGCAGGGATATCATATATCGAGGGTTGGTAGGT"